Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-E432771

Search information 
Request: 432771Match: SGN-E432771
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279888Clone name: STM-57-D21
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E432771Length: 765 bp (925 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E432771 [] (trimmed) GTCAGTTAAGCGGTTGAGGTATAATCGACTCCCCGGAGAATCCGCTGCGGCAGTAGCACCTGCACCCGCACCTGGTCCTTCTCGTTCTCCTGCTC
CTTCTCCAATTGGAATGCCTGTAGAGACGCGTTCACCACCAGTTGTCAAAGGGGCAAAATTTCAGTCACTTAATAAGCCTGCAGTTCCTGCACCT
GCTGTGCCAGTTGAGGTGGAAAGGATCGAAGTTGGTGACTTTAGAAGTTCAGATTCAAGACCCAAAAATGAGAAGATTGCTGAGTATCCATCTTC
ACATGCAAATCATTCAACTGCATCACCAGTCATGAAGTATGATGACCTGGATGAACAATTAGATATACTGAATGATGATGAGGATGATACTACCG
CAGCCAATGGTGGGAATGTTACTGTTGAAGAATTCAAAACTGGCATTGATATTAATATCCCACACCAAAATGATACAGATGATGAGATAGCTGAT
GTGGATGTAAGTGATGATGATGAGGACAAGGGCCGCAATGCTGCAGAAGAACTTAGAGCTCAAGTAAATGCAGAGGGAAAAGAGAATCATACTTC
GAGTTCTAGCAGTAGCAGCAGCAGTGACAGTAGTGGAAGTGGGAGTGGGAGCGGGAGTGGAAGTGGAAGTGATAGTGCAAGCAGCAGCAGTGACA
ATGAAAGCAGTGACACGGTCAACTCTATCTGAGAACTTTAAGTATTTTGAGGGTGAATGTCTNCAGTTTGAAATAATTCAAAGAGAAGCACTACA
TTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E432771] SGN-U271748 Solanum tuberosum Build 4 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T284908 [Download] [View] Facility Assigned ID: STMIS23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5