Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E432850

Search information 
Request: 432850Match: SGN-E432850
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C280068Clone name: STM-57-L17
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C280068 [STM-57-L17] Trace: SGN-T284988 EST: SGN-E432851 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E432850Length: 808 bp (929 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E432850 [] (trimmed) GTTCTACTTGATGAAGAAATGAATCCTAAAATTTCAGACTTTGGCATGGCAAGACTATTTACATTGGATGAAACTCAAGGCAATACAAGTAGAAT
TGTCGGGACCTATGGATATATGGCACCAGAGTATGCAATGCACGGACAATTTTCAGTCAAGTCCGATGTTTTTAGCTTTGGAGTACTGGTCCTAG
AAATTTTAAGTGGACAAAAGAACGCTTGTTTCAGAAATGGAGAATCTGTGGAAGACCTTCTAAGCTATGCATGGACGAACTGGCAAGAAGGAACA
GCTGCAAATTTGATTGACCCCATATTTAGGGTAAGTTCAGGACTGGTTCGTGACATAATGAGATACATCCACATTGCTTTATTGTGTGTTCAAGA
AAATATTGGTGATAGACCAACTATGGCTGCAGTAGTCCTCATGCTCAATAGCTTCTCTCTGAGCCTTCCCGTACCTTCAGGGCCTGCATACTACA
CACACAACGATATTAGCCCAGAAATTTCACTTATTAAAGAGTACAATTCAAGATCGTCAGAACGTAGAGAATTAGCCAAAAGTAAATCTATTTCT
TCATCACGTAATGAGGCATCCATAACTGAGTTATATCCTCGTTAACATTCTTTGGCATAATACCCTACTTTTCTGAGCTACTTTGTTATTTGTTC
GAACTCCAATTAGTTTGGAATTGACATTGATTTATTAATGGTTTTTGTGCTCCGCACAAAAGGCAACTTGTTTCATATGTATTAGNTGTATTATT
ACACTAGNTAAATAAGTTCAACTTGTATTGGAACTAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E432850] SGN-U271841 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T284987 [Download] [View] Facility Assigned ID: STMIS69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0115 Quality Trim Threshold: 12.5