EST details — SGN-E432971

Search information 
Request: 432971Match: SGN-E432971
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279983Clone name: STM-57-H4
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279983 [STM-57-H4] Trace: SGN-T285107 EST: SGN-E432970 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E432971Length: 821 bp (872 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E432971 [] (trimmed) ACAACTTTTTTTTACAAAATAGATGATATTTGTATAGAGTCTAAAACTGAAGCCACAAAGATTGTTGCATCTCTGATTTGTTATCTTTCTATGCA
CAAGTGCTGCCCCAGAAACAGAATACTGGCACTTCACAACTGTTGAATCAAGTCTCTCTAATAAAAGTGATACCTAACTAAGAGAAACAACACTT
GTAAATTGTTTATAAAATCAAAAATCTTTCAGGTGGCATCACAGATTGCTTCTTGATCTCTGTACTATTTCTGTAAAGGATCTCTGTGCTCCCTA
AAGTATGTTCTTCTTAAAAGCTGATACCATCTTTGGTGAAAACAGAAAAACAAATGCTAAGAGTGATCCGAAAAACATTTTCAAAAAATATTGCA
TGGGATCATTATCAACTTCTTCCTCTGTACCAGTGGACGGTGACATTGCCATTGTCGAAGGCAATGCTTCAATAACTGCATCTGCCAGATCAGTT
ATGAAAGAGGAGGTGCAATTCAGAGCAGGAACACGACCCCAATGTTCAATTCCCGATTCAAGTGCTAACTCCTTGTATTCCATATCAATCTCTTC
AAGAGTCTCTATATGCTCGCTCACAAAGCTTACAGGAACAGCCAACAGAGACTTTACACCTTTCTGTCCAAGCTCAACAAGAACTTCATCAGTGT
ATGGCTTCAACCATTGTACAGGACCAACTCGGCTCTGGTAAGCCAACGTATGATCATTGGTGATTTCTCTAGCTTTCAGCTCTTTCATTATCAAG
AAAATGCACTCTTCCATCTGATCTCTATATGGATCACCAGCATTTTCAACATAACTGACTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E432971] SGN-U274252 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T285108 [Download] [View] Facility Assigned ID: STMIT38TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0079 Quality Trim Threshold: 14.5