EST details — SGN-E433062
| Search information |
| Request: 433062 | Match: SGN-E433062 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C280178 | Clone name: STM-57-P8 |
| ||
| Library Name: STM | Organism: Solanum tuberosum |
Tissue: mixed tissues
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C280178 [STM-57-P8] | Trace: SGN-T285200 | EST: SGN-E433063 | Direction: 3' | Facility: TIGR |
| Sequence |
| Sequence Id: SGN-E433062 | Length: 170 bp (945 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E433062 [] (trimmed)
TCTACTCTGCATCTTTAGAAATGTATTTGTTCTGTGCCTTAGTAGAAAAGAAACAATTTTGTACACTTAACAACCAGTTGGTTTTGTTATCTTCA
TATTTTTGGTTCCTAAAAGTTATGAGTGGAGTTTCATAATATTATTTACCTTATCAGGAAAAAAAAAAAAAAAAA
TATTTTTGGTTCCTAAAAGTTATGAGTGGAGTTTCATAATATTATTTACCTTATCAGGAAAAAAAAAAAAAAAAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E433062] | SGN-U274805 | Solanum tuberosum | Build 4 | 6 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T285199 [Download] [View] | Facility Assigned ID: STMIT88TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.891 | Expected Error Rate: 0.0095 | Quality Trim Threshold: 12.5 |
Working
