EST details — SGN-E433063
Search information |
Request: 433063 | Match: SGN-E433063 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C280178 | Clone name: STM-57-P8 |
| ||
Library Name: STM | Organism: Solanum tuberosum |
Tissue: mixed tissues
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C280178 [STM-57-P8] | Trace: SGN-T285199 | EST: SGN-E433062 | Direction: 5' | Facility: TIGR |
Sequence |
Sequence Id: SGN-E433063 | Length: 171 bp (852 bp untrimmed) |
Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E433063 [] (trimmed)
AAAACTTTTTTTTTTTTTTCCTGATAAGGTTTTTAATATTATGAAACTCCACTCATAACTTTTAGGAACCAAAAATATGAAGATAACAAAACCAA
CTGGTTGTTAAGTGTACAAAATTGTTTCTTTTCTACTAAGGCACAGAACAAATACATTTCTAAAGATGCAACAAAA
CTGGTTGTTAAGTGTACAAAATTGTTTCTTTTCTACTAAGGCACAGAACAAATACATTTCTAAAGATGCAACAAAA
Unigenes |
Current Unigene builds | |||||
[SGN-E433063] | SGN-U274805 | Solanum tuberosum | Build 4 | 6 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T285200 [Download] [View] | Facility Assigned ID: STMIT88TV |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.874 | Expected Error Rate: 0.0083 | Quality Trim Threshold: 12.5 |