EST details — SGN-E433562

Search information 
Request: 433562Match: SGN-E433562
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C280505Clone name: STM-58-N5
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C280505 [STM-58-N5] Trace: SGN-T285698 EST: SGN-E433561 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E433562Length: 600 bp (863 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E433562 [] (trimmed) AAATGAAACTTATCACCCCTTATTCAAATGAAAAGCACTGCTTTTAATTTATCCTTCTCTCTTTCTACATACATTTTTGCTCTCAAGGTAAACAA
AATTCACAAGAAAGGGAAAAAGAAGGTTAACAAAAGTTTATGAAGAAACGACTGGGGATTTGGGAGTAGAAAAACATACATCTAGAAAATAATGA
AGCTTGTATGTTTAACTTTCTACCCAGGCATCTCAAAAGGATCCCAGAGAATAACAAAATTTATCGATCTTCTTCATTCTTTCATTTTTCTATTG
TTCCATTTCCTCTGAAGAAGTTTCTGCATCATAGTTCTTGCCAAAGCCAAGTTCTGACATGTCTTGCTTTGCCATCAAGTTCTTCTCCATACGGC
ACACCAGGTACTTTTTAGAGAGGTGTCTACAGTTGTCAGATTTATGCCCAGAGGATTTAAGACAATTGAGGTACTCTTTCTTCTCCAGGTCACAT
AAATGCATATGGTCCAAAGGAAAAACTCCTTTTTCAGGTGGCACTGGTCTCAGTCCTCTATTTCCACCAAATGCTCCCCCTGCACTCATTGTCGG
AGACGTTGATCGTCGTAACCTTCCTTTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E433562] SGN-U285062 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T285699 [Download] [View] Facility Assigned ID: STMIW75TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0045 Quality Trim Threshold: 20.5