EST details — SGN-E433598

Search information 
Request: 433598Match: SGN-E433598
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C280547Clone name: STM-58-P21
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C280547 [STM-58-P21] Trace: SGN-T285736 EST: SGN-E433599 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E433598Length: 767 bp (908 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E433598 [] (trimmed) TTTACTCGGAGCTCCTGAGAACTTGGTAGAAGTGATAACAGGCTTTGCTGAAACTGGAGAAGCACTAGTATCCTCTGTTGACAAAATCATATTTG
TTGGATCTCCTGGTGTGGGCAAAAAGATTATGCGAAGTGCTTCAGATACACTAATACCAGTTACCCTTGAGCTTGGTGGAAAAGACGCATTTATT
GTCTGTGAAGATGTTGATGTGCCGCATGTTGCACAAATTGCTGCTAGAGGAGCTCTCCAATCAAGTGGGCAGAATTGTGCTGGTGCAGAACGCTT
TTATGTTCACAAGGATGTTTACTCTTCTTTTGTTGCTGAAATTGTCAAAATTGTGAAATCGGTTACTGCTGGACCTCCTTTGTCCGGCAAGTATG
ACATGGGAGCCATATGCATGCAAGAGCATTCTGAAAGGCTTCAATACCTAGTAAATGATGCCCTAGACAAAGGTGCTGAAATTGTTGCTCGAGGA
AGTGTAGGCAATATTGGCGAAGGTGCTGTTGATCAGTACTTCCCTCCTACTGTGGTTGTTAATGTGAATCACACAATGAAACTGATGCAGGAGGA
GGCTTTTGGACCAATATTGCCGATAATGAAATTCAGCTCTGACGAAGAAGTTGTTCAGCTTGCAAATGATTCAAGCTATGGGCTTGGTTGTGCTG
TATTTTCAGGCAGTCAGCGTCGTGCTAGGCATATAGCTTCACAATTACATTGTGGANGGGCTGCTATNCATGACTTCGCATCAAATTACATGTGT
CAGTCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E433598] SGN-U272066 Solanum tuberosum Build 4 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T285735 [Download] [View] Facility Assigned ID: STMIW95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0092 Quality Trim Threshold: 14.5