EST details — SGN-E433599

Search information 
Request: 433599Match: SGN-E433599
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C280547Clone name: STM-58-P21
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C280547 [STM-58-P21] Trace: SGN-T285735 EST: SGN-E433598 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E433599Length: 728 bp (863 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E433599 [] (trimmed) GTCTGCTCCACTTGTTTATCTATTTGCTTCTCTAAAAGTAGATAATGTTGTAATACAACAAAGAACAATTGGTTTGGTCAATTGTTTACATAGAT
TTATTTACTAGTGTAATCTGTCTGAATGTGTCTAATAGATATACTAGTGTAATGTAGCCATTTTGGGACCAAACCTACTTCGGTATATTCTTGGG
TCATATCAGTCACATTTTAACAAAGCCATGGATAGAGAATTATTTCGATTTGATCTGAATAATCCTGACCAAAACCAAAATTGTTTATCTAAGTA
AATCAAAGGTAAACATGAGTAGGAGTTCAACTACACCATAGAAACTGGCAATTGCATTTAAAGTGTTTGTTTTTAAGCTTCTGGCAAAAAAGATG
AGCGAGCTGTGGTCTTAGTCGTTTCTCCTCCTATTGCTTGTGGGAGCGGGGGGTTGCTCTGAGAGGATTTTCAAAACATTCACCAATGCCCGTAA
ACGATCCCAGATGTTCAAACCATAAAGAGTGTGCACCAGAGACTCTTGGAACTCGAATCCATTCTCAGCAATAGGATACTGAATAGGCTTTGGTA
TCTTGGTTTTAATAAATGGCCACCACCGGTCCTCCACAACTGACTTTACGAGACAGCAAGCTCGTAATCCTTCAATACCAGCAAATCTTCCAAAT
CCACTGTCTTTGACTCCACCAAATGGCAAGGACTGACACATGTAATTTGATGCGAAGTCATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E433599] SGN-U272066 Solanum tuberosum Build 4 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T285736 [Download] [View] Facility Assigned ID: STMIW95TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0032 Quality Trim Threshold: 20.5