EST details — SGN-E433904

Search information 
Request: 433904Match: SGN-E433904
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C280845Clone name: STM-59-M13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C280845 [STM-59-M13] Trace: SGN-T286042 EST: SGN-E433905 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E433904Length: 770 bp (845 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E433904 [] (trimmed) TGGCGCAAAATGGTTCAGTTGAAGAGTTTCTTGATGTTGCAGTTGAAGCTGCTAAAAGAGCTGGAGAGATAATTCGCCAAGGATTCTACAAGACT
AAGCATGTGGAGCACAAAGGAGTGGTGGATTTAGTCACAGAGACTGATAAGGCATGTGAAGATCTCATTTTTGACCATCTCAAGCAACGTTTCCC
CAGCCATAAGTTCATTGGTGAAGAAACAACTGCTTCTTGTGGAAATTTTGAGCTGACTGATGAACCAACTTGGATAGTTGATCCACTTGACGGAA
CCACTAACTTTGTGCATGGGTTCCCTTTTGTCTGTGTATCAATCGGTCTCACAATTGAGAAGAAACCAACAGTTGGTGTTGTTTACAACCCAATT
ATCGATGAGCTTTTCACCGCAATTGATGGAAAAGGTGCTTTTCTCAACGGGAAGCCTATCAAAGTATCTTCACAGTCTGAACTCGTGAAGGCTCT
TCTTGCTACAGAGGCCGGAACGAACCGGGATAAGTTAACTGTAGATGTTACAACAGGGAGAATCAATAGCTTGCTTTTCAAGGTTAGGTCCCTTC
GAATGTGTGGTTCTTGTGCATTAAATCTCTGTGGAGTGGCGTGTGGAAGGCTTGATCTCTTCTACGAACTTGAATTTGGTGGCCCTTGGGATGTG
GCAGGTGGTGCTGTGATAGTGAAAGAAGCTGGAGGCTTCGTGTTTGATCCATCTGGTTCAGAATTTGACCTCACAGCTCGACGGGTAGCTGCTAC
AAACGCTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E433904] SGN-U273059 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T286041 [Download] [View] Facility Assigned ID: STMIY79TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0069 Quality Trim Threshold: 14.5