Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E433988

Search information 
Request: 433988Match: SGN-E433988
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C280672Clone name: STM-59-E6
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C280672 [STM-59-E6] Trace: SGN-T286124 EST: SGN-E433987 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E433988Length: 746 bp (869 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E433988 [] (trimmed) ACAACCTTTTTTGATCTATCAATAAAATATTTTTACTTTCTTCATTAAAAAAAATCTACTTAATGTTGACATAATTTGTGTGTGTACGTACAAGA
AAGATATGGAGAAAAATAAGAAATGAAAACACAATAGAGTTTCGAATTTGAACTAATAAACATCGTATAATTCGTACCTAATTATTAATCATTGT
CTTTCAAGATCATTAATTACATCCTCTTCAACACCACAAAATTGAACATGTAATCTTCTTGATGATTTTTCCATGCTAATCATCTTCCTAAACGA
GCTTAATCTCGAACTTGATCCATTAATTTTAGCTGATGATGATGTTGAATCTTGTGTTAATCCACAATCTTCCACATTTGTCGAATCGCCACCCT
CGATTGGTGGCGCTGAAGGTGTGGTAGGCCCTACCACGCCCTCACGTGGCTCCGGTTGTAACAACCGGGGCTCCGCCTCAGTCCGACAAATCGGG
CACGTTGAATGTGACCCGAACCACTTGTCAATACACTCAGCATGAAAAACATGTTTGCAATTAGGCAAATTCCTAACCGTTTCTCCGTCTTCAAG
AGCGCTCAAACAAACCGTGCACTCAATTGAATTATTTTGATTAATATCATTTTGTTTGAGAATAAATACCGGTAGCGAACTATGATGGGAACCGG
GTCGAGCCCCCGTCTTTGGGGGCTCGACCTGTAGGGCGGAGCTGGGTGATGATGCTAACGCGCTGAAGCTCAGCCCTACGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E433988] SGN-U275061 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T286125 [Download] [View] Facility Assigned ID: STMIZ27TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0110 Quality Trim Threshold: 14.5