Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E434144

Search information 
Request: 434144Match: SGN-E434144
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C280648Clone name: STM-59-D5
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C280648 [STM-59-D5] Trace: SGN-T286282 EST: SGN-E434145 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E434144Length: 172 bp (861 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E434144 [] (trimmed) GAAGAAAGCTCAGAGACAACGGACTTAATGTTGGAATAATCTCATCAACATGCATTTGATATTTTGTTCTTTTACTTTGTCTGAATTTTCTCATC
TGTTATTTGCTTCGACTACTGAATTGAAGTTATAAAAGCAGTTTTCTTTGCTTGTGCAGCACTTTAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E434144] SGN-U271638 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T286281 [Download] [View] Facility Assigned ID: STMJA15TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.886 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5