Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E434323

Search information 
Request: 434323Match: SGN-E434323
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C280651Clone name: STM-59-D8
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C280651 [STM-59-D8] Trace: SGN-T286461 EST: SGN-E434324 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E434323Length: 671 bp (889 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E434323 [] (trimmed) ATAACTTCGATCCTGCCAACAAAATTGGTGAAGGAGGGTTTGGACCAGTTTACAAGGGAGTACTCGCTGATGGTGCCATCATAGCTGTTAAGCAG
CTGTCTTCCAAGTCGAAGCAAGGAAATCGTGAATTTGTCAATGAGATAGGCATGATTTCAGCTCTACAACACCCAAACCTTGTCAAGCTTTACGG
TTGTTGCATAGAAGGGAACCAGTTATTAGTGATATACGAATACATGGAAAATAACTGTCTTGCTCGAGCTCTCTTTGGCCGTGACGACCAGAGGT
TGAACATAGACTGGGCAACCAGAAAAAGGATATGCTCAGGAATAGCAAAAGGGTTAGCTTACCTTCATGAAGAATCAAGGTTGAAAATCGTACAC
CGAGATATAAAGTGTACCAATGTGCTTCTTGATAAGGATCTGAACGCTAAGATTTCAGATTTTGGATTGGCTAAATTAGATGAAGAAGAGAACAC
TCATATTAGCACCCGAATTGCTGGAACAGTAGGTTATATGGCTCCGGAGTATGCAATGAGAGGCTACTTGACAGATAAAGCTGATGTTTATAGCT
TTTGGAGTTGTTTTATTAGAGATTGTCAGTGGGAAAAGCAACACAAACTACAGGCCAAAAGAGGAATTTGTTTACCTTCTTGACTGGGCTTATGT
CCTACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E434323] SGN-U273641 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T286460 [Download] [View] Facility Assigned ID: STMJB16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5