EST details — SGN-E434369
| Search information |
| Request: 434369 | Match: SGN-E434369 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C280725 | Clone name: STM-59-H10 |
| ||
| Library Name: STM | Organism: Solanum tuberosum |
Tissue: mixed tissues
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E434369 | Length: 195 bp (877 bp untrimmed) |
| Status: Current Version | Direction: 3' |
>SGN-E434369 [] (trimmed)
TTTTTTTTTTTTTTTTTTTCAATGTTGAAAATTAATGCGATAGAAAGAAAATAAAGTATCTCTCTAAGTGAGAACACTGATAATCCTTCTTCTAA
TTTGTTAGAAGAAAATATTATTGCATTAAACAATGGGAAAACAAGAAAAGTACAATATTATTATGAATTAAAGATGTGGGTTAGTAGGTTGTTGA
TGTTG
TTTGTTAGAAGAAAATATTATTGCATTAAACAATGGGAAAACAAGAAAAGTACAATATTATTATGAATTAAAGATGTGGGTTAGTAGGTTGTTGA
TGTTG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E434369] | SGN-U280385 | Solanum tuberosum | Build 4 | 3 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T286506 [Download] [View] | Facility Assigned ID: STMJB41TV |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.868 | Expected Error Rate: 0.0038 | Quality Trim Threshold: 12.5 |
Working
