EST details — SGN-E434497

Search information 
Request: 434497Match: SGN-E434497
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C280985Clone name: STM-60-C15
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C280985 [STM-60-C15] Trace: SGN-T286635 EST: SGN-E434498 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E434497Length: 731 bp (908 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E434497 [] (trimmed) GAGAGCGAGAGGTATTGCTCCGACCAAAGTAAGTTACACCACTTTGATGAAAGCTTTTGCCTCGTCTGGTCAGGCTAAGCTAGCTAACAAGGTGT
TTGACGAGATGCTTAAAGACCCTCGAGTGAAGGTTGATTTGGTGGCTTGGAATATGTTGGTAGATGCATACTCTAAGCTGGGAAAGGTTGAGGAA
GCAAAGAGTGTGATTGAGAGGATGAAAGAAAACGGATTCTACCCGAATGTGGCCACTTATGGCAGTCTTGCAAATGGGATTGCTTTGGCTAGGAA
GCCAGGAGAAGCGCTCTTGCTTTGGAATGAGATAAAACAGAGGTGCGGAATGGGAAATGGAGAGGAGTCTATTCCCTCTTCAGGCGTCCCGCCAT
TGGAACCTGATGAAGGACTGTTGGATACTTTGGCAGATATATGTGTCAGGGCGGCTTTCTTCAAGAAAGCTTTGGAAATCGTTGCTTGCATGGAG
CAACACGGGATACCACCAAATAAGACCAAGTTTACTAGGATCTACGTCGAGATGCATTCAAGGATGTTTACTAGTAAGCATGCGTCGAGAGCTAG
ACAGGACAGGAGAAAGGAACGCAAACGAGCAGCTGAAGCATTCAAGTTNCTGGTTGGGATTGCCCAACTCCTATTNATGGAAGTGAGTGGCGCCT
TGATTCAGTAATCGACGATGAATACAAATCCGAATAATTGAAGATGAAAACATAGGTATTAAACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E434497] SGN-U277138 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T286634 [Download] [View] Facility Assigned ID: STMJC20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0097 Quality Trim Threshold: 14.5