EST details — SGN-E434704

Search information 
Request: 434704Match: SGN-E434704
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281072Clone name: STM-60-G18
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281072 [STM-60-G18] Trace: SGN-T286842 EST: SGN-E434705 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E434704Length: 672 bp (906 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E434704 [] (trimmed) TTGCTGCAAATGACGGGAACTGTAGAGAGCCGAGACATGAAGGAACAGTTTCTAGATAATATGGATTTGGAGAGAGAGAGAGGCATCACTATCAA
ATTGCAGGCTGCTCGAATGCGTTTCATTTATGAAAATGAGCCATATTGCCTTAATCTGATTGACACTCCAGGTCATGTAGATTTCTCGTATGAGG
TGTCTCGGTCTCTTGCTGCCTGTGAAGGTGCATTGCTTGTAGTTGATGCGTCCCAGGGAGTAGAGGCGCAAACCCTGGCTAATGTGTATTTAGCA
TTGGAAAACAATCTTGAGATCATCCCGGTTTTGAACAAGATTGATCTTCCAGGAGCTGATCCAGCTCGTGTTTGTCAAGAGATAGAAGAGATTGT
TGGCCTGGATTGTAGCAATGCCATATACACCTCAGCAAAGGAAGGAATAGGTATTACTGAAATTCTAAACGCGATTGTTCAGAGGATTCCACCTC
CACATGATACTGCCGAAAGGCCTCTGANGGCTCTTATATTTGACAGTTACTATGATCCATATCGGGGCGTTATTGTCTATTTTCGAATCATTGAT
GGGACTATTAAGAAAGGTGACAGAGTGCTTTTTATGGCCAGTGGGAANGGATATTATGCTGATGAATTAGGAGTTTTATCGCCCTACCAGTTGCA
AGTTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E434704] SGN-U285850 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T286841 [Download] [View] Facility Assigned ID: STMJD45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0146 Quality Trim Threshold: 14.5