EST details — SGN-E434711

Search information 
Request: 434711Match: SGN-E434711
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281079Clone name: STM-60-G24
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281079 [STM-60-G24] Trace: SGN-T286847 EST: SGN-E434710 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E434711Length: 707 bp (873 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E434711 [] (trimmed) TTCTTTTTTTTACAGATCCTCGGGTTACCAAGGAGAGTCATTTTCAATACACAAGTATCAGCAGTAACTGCTGTTGTAATATATCAAGAATTACA
AGAGGAGGCTCAAATGAGTTTCTTGTTGATTGTTAATCAGTGGTAACGTGGTAGAAGAAAATCCGGAGTTCAAACAATATTTGACAATAAAGAAT
ACAGAAACTACGCCAAAACCTTGAAGAGGTCTTCAGAGAAGCAACAACAACAAACCCATAATAGCTGTTACAATCATCAGGATCGGTGATAGTCT
ACAGCTCATATGACTATTATTAGCACTGGCAGATTCTGATGATGCAGAATCAGGACATGGTAGCCCCTTTTTGTCACCAGTGCACTCGCTGGCAA
AAAGACCGGGTGGGTACTTCCCGTGAAGATTAATGTAGCTGAACATGGTAGAGGCACAATCAGTTGTCAAATCATTCACATAGTCTGAATAGGGA
CAAGCAAACTGCGCAAGGGCTTCACAACACTGTTTGGCTGGGTATTGCGGTCCTCTGCATTGGGTAGTGACGACTGTGTAGTTTTGAAACTCGAA
GCTGATAGGACAAGGTTTCTTGGCTTGAAGTAGATTCCTCCCAGTTAAACCTTCATTAACAAAAATCCCATCTGATAAATAAGCTGAAGCTGAAG
CTGAAATGAAGAAAGAAAACNGTAGAAAAATACAAGAAAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E434711] SGN-U273410 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T286848 [Download] [View] Facility Assigned ID: STMJD48TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0068 Quality Trim Threshold: 12.5