EST details — SGN-E435037

Search information 
Request: 435037Match: SGN-E435037
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281189Clone name: STM-60-L4
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281189 [STM-60-L4] Trace: SGN-T287175 EST: SGN-E435038 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E435037Length: 676 bp (868 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E435037 [] (trimmed) GGGGGCTGACACTGTTTATGCCGCCGACATCTGCTGCTCAGACGGTGCGCATTTGTGCATTTCCAGCCGGTCGTTTGGGATTGCAAGGAATTGGG
ATAAGTCCTGACTGCAACCCTGAAAATAGGGCCACTCCTCGCCAGCTTCTCAACTGGGCACTTGAGCCTGCAGAAGATGATATTCTTGATAAGCT
CTTTGAACAAGGTTATGCTGATGCAGCTGTGTGGGCCCAGGAGAACCCAGTTGAGGACTTAATTCGAGATGATGACAGTTCTTCCATAGGCAGCA
GTCTTGTACAATAGGTTTATCATAAGGACTGATTTAGTTTAAGAGTGTATGAGATCAAGATGATACACGGACGCTGCAATAATCAGCTCTAGGGT
ATACTTCAACAATGATGGAGCTGTTGCCTTAACAAGGAGCTGATACTGAGGAAGAATGAAGAGGGTCCGAAACTTGTGGTAGGTTAGCAGCAAGA
TTTTGTATATAACATTGCAAAGATGTAAATTGTAAAGGATTCACAGAAAAACAAAAAAGAGCACAGGATTTTGGATATGGAGTATTATTGGGGTT
CTACTTCTACACTTCCTATACCAGTTGCTGATGGAAAAAAGTAAGAGCAGCCCACTATTTTAGAGACTCTAAGTCATATTAGACCTTTTCAGTTA
CAAATTGCTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E435037] SGN-U276894 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T287174 [Download] [View] Facility Assigned ID: STMJF62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0090 Quality Trim Threshold: 14.5