EST details — SGN-E435084

Search information 
Request: 435084Match: SGN-E435084
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281269Clone name: STM-60-P12
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281269 [STM-60-P12] Trace: SGN-T287222 EST: SGN-E435085 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E435084Length: 495 bp (895 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E435084 [] (trimmed) TATTACCCTCAACAGGGCCCACAATTCTACGCCCCAGCCCCAGCACCAGCATACGTCGTTAGCTACAATACGGCTCAACCTACGGCTAACTATAC
GGCGTCGTATTATGCTCCGGCACCTCCAACTTCGTATGCGTATACGTATCCCGGTCCTAGTCATGTAACGGAACCTCCACCATCCGATGTGGATA
TGTATCCACGCCAGCCGTTGGATTCGTTTGAAATGTTTAGTGATGAAAATCCTAACGGATGTTTTATTATGTAATGCAATTACAAAATCCTACGT
AGGGTTTCGTGTATACAGGCTTATACTACTTGTATAAGTACATGTATTATGTAGATATAAGTATAAAAATGGAGAAATTAGGGTATAATTTAGAA
AATGTTAGGTGTTAGTGTTGGGGGTCTTTAATCTTTTAGTGGGTTGTTGCCTCTTTGTTGAAGTTTGTAGCTTTATTTAGTAAACATTTTCGTTT
TTTAGTCTTAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E435084] SGN-U276535 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T287221 [Download] [View] Facility Assigned ID: STMJF90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0074 Quality Trim Threshold: 12.5