Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E435103

Search information 
Request: 435103Match: SGN-E435103
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281295Clone name: STM-61-A17
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281295 [STM-61-A17] Trace: SGN-T287241 EST: SGN-E435104 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E435103Length: 755 bp (916 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E435103 [] (trimmed) ATACTGGCTATTGTAATGGGCCCAAACATGAGCGGAAAAAGTACTTATCTTCAGCAAGTTTGTTTAATGGTCATCCTTGCTCAAATTGGTTGCTA
TATTCCTGCTCGATTTGCCACTTTGAGGGTGGTCGATCGTATTTTCACAAGGATGGGAACAATGGACAGTCTTGAATCAAACTCTAGCACGTTCA
TGACAGAGATGAAGGAGACGGCTTTTATCATGCAAAACGTGTCCAATAGAAGTCTGATTGTTATGGATGAATTGGGGAGGGCAACTTCATCCTCT
GATGGATTCGCAATCGCGTGGAGCTGTTGTGAGCATCTATTGGCAATTAAAGCGTACTCAATATTTGCTACTCATATGGAAAATTTATCAGCGCT
ATCCACCATGTATCCAAATGTAAAAATTCTTCATTTTGATGTTGATGTGAGGAATAACCGTATGGACTTCAAGTTTCAACTGAAGGATGGATCAC
GTCATGTGCCACATTACGGCCTCATGTTAGCAGGGGTAGCTGGATTACCAAGTTCAGTGGTGGAAACTGCTAAAAGAATCACATCTAGGATCACA
GAGAAGGTAACTTGTTTCACTTCCTCAATGAATGTCTTATTTGGGAATTGCCATTGTGTTGAAAGATTTTGTAGTTCATTTTACCATTGCGAGTT
CCACTTCTTTCCACGCCCTGTTCTCTTCCAAACAGGAAAAACAGAATTTGAACCTGAAACATCATGATTATTAATTCACTTTATTGATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E435103] SGN-U282579 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T287240 [Download] [View] Facility Assigned ID: STMJG09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5