Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E435120

Search information 
Request: 435120Match: SGN-E435120
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281333Clone name: STM-61-C17
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281333 [STM-61-C17] Trace: SGN-T287258 EST: SGN-E435121 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E435120Length: 793 bp (889 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E435120 [] (trimmed) CTGATGTTGGCCTAAGACCAAATATGCCATATTTCAAGTCAAAAGTATCAGATAGACCTCCTAAAATAACATACTTGCATCTCCATGAATGTGAC
AAATTCTCGGTATGCAGCCAATTAGGTCGACCTTTCCTAAAATTTAATATCGTTTAGGTGACTTAATAGTTAAATTCTTCAATATATTGTCAGTT
TATAGAAGTTAAAATCGCTATTTCACTTCTAACTCTTGATTGAAGATTTAAAGTTTGTTCATATTTTGTTAGATTGGTATCTTTTGCTTACCACC
AAAAGCAGTCATTCCTCTTCATAACCATCCTGGAATGACAGTTTTCAGCAAGCTTCTCTTTGGGAAAATGCACATAAAGTCTTATGATTGGGCGG
ACAATCTCCTTCCTGAATCAACTACCCCAAATGCCAATATTTCTGACAGGGATTGTACAGGACTGCGTTTTGCAAAATTGAAGGTGAATTCCAAG
TTTAAAGCTCCTTGCAAAACTTCAATCCTCTATCCAGCTGACGGAGGTAATATGCACTGCTTCACAGCAAAGACAGCCTGCGCCGTACTAGATGT
TCTTGGCCCACCTTATTGTGATCCTGAAGGTCGCCACTGCCAATACTACTATGACTTCCCCTTTGCCAACATCTCAGTGAATGGCTTGTCAGTAC
CAGAGGAACAGCAAAGTGAGTATGCATGGCTCAAAGAGAGAGAGAAACCTGAGGACTTAACTGTAGCTGGAGCACTGTATAGTGGACCAAATTTA
GTGTAGTAAACCGATGGATCAATTGCTTGTGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E435120] SGN-U275431 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T287257 [Download] [View] Facility Assigned ID: STMJG21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0084 Quality Trim Threshold: 14.5