EST details — SGN-E435194

Search information 
Request: 435194Match: SGN-E435194
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281504Clone name: STM-61-K15
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281504 [STM-61-K15] Trace: SGN-T287332 EST: SGN-E435195 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E435194Length: 650 bp (904 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E435194 [] (trimmed) CTTCAGGGTAGGCTACACAACAGAAAGGCTCAAGAGGCTGATGCGAAGGCTAGCCAGGATATATTTGCAGCTAGAAACAAGAACATAGAAAATAT
GATAACTATCGACTTGCATGGGCAACATGTCAAACCTGCAATGAGGCTTTTGAAACTGCACCTTCTGTTTGGAGCATTTGTACGCTCTGTTAGGT
TGTTCAGAGTTATCACGGGATGTGGGGCACATGGCGTTGGGAAGTCGAAGCTGAAAAACTCGGTAGTTGAACTTTTGAAGAAAGAACGTATTGAA
TGGACTGAGGAGAATAGAGGAACATTGCTTATCAAGCTCGATGGACGAATGAATTTTAGCTTTCTAGATACTGATGATGATGATGATGATAACTG
ATCATCCCTTAGGCATGGTTGCTAGCAGTTGGGCGCCGTGGATTTTAGCATTAACAGTGGCGCTAAATGTAATTAACATCACTATATTATCTGGG
TGCTAGGTGGTGTAACCTAGATTATGATATTTTACGACATTTACATTTTCTTTTGTTAGTGTGAGAATTGTAAAGGTGTATCCTAGCTCTGAGTA
TTATGCAGCATGATAGCTAAGCTCATGTATCAGTGTAGAATGCACATTATTGTAGTAACTGTAATACTCATTTATTCTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E435194] SGN-U274419 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T287331 [Download] [View] Facility Assigned ID: STMJG68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0035 Quality Trim Threshold: 12.5