EST details — SGN-E435229

Search information 
Request: 435229Match: SGN-E435229
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281586Clone name: STM-61-O13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281586 [STM-61-O13] Trace: SGN-T287367 EST: SGN-E435230 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E435229Length: 546 bp (894 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E435229 [] (trimmed) GTTCTTCTTCATCTATGCCTATGTGTGACATCTGCCAGGAAACAGTTGGCTATTTCTTTTGTCTTGAGGATCGGGCATTACTTTGCCGAAAATGT
GATATTGCTATTCACACAGCTAATCCTCATGTTGCAGCTCACCAAAGATTTTTGCTGACTGGAGTGAAAGTAGGACTTGAACCTGTTGATCCTGG
TGGTATTTCATCCTCAGGGACGTCACAGTCCATTCAGAAGGTTTCTGAGCCAGAGTCTGCTCCACTTTCTAAACGAAATGCCCCAGTATCATCGG
ATGCTCAATTTAACAAAGTATTACCTACCCAGGCTAGTGGGGTTGGTGATTTTGCTCCTACTAAGTCTCCGTTTGCTGGAGGTTCTGCAGCTGGA
AGTATGCCGCAATGGCAGTTCGATGAATTTATTGGTCTGAGTGATTTCAATCAAAATTATGGATACATGGATGATGGATCATATAACGCGGATAA
TGGCAAACTTGGTGGAGAGTCAGACTCTTCATCAATCTTAAGAATTGAAGATGAAGAACTAAATGGTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E435229] SGN-U280862 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T287366 [Download] [View] Facility Assigned ID: STMJG91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5