EST details — SGN-E435291

Search information 
Request: 435291Match: SGN-E435291
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281382Clone name: STM-61-E22
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281382 [STM-61-E22] Trace: SGN-T287429 EST: SGN-E435292 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E435291Length: 566 bp (885 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E435291 [] (trimmed) CTCAGCTACAAAACTTTGATTATTACTCAATATTTCCGATTTTCACAGTATCTGTAAATCCCTAATGGACCTATTGCGATCCTACGCCGAGGACG
ATGAAATCGCTAACCCTAATTCCCAATCTTCGCCGGATTCTTCTCCAATCCGAATGCTTCCTTCTAAATCCGCCGCCCCTAAAGTCGACGACACC
ATGCTAGCCCTAACAGTCGCCGGCGAAGCTGCAAGAGCTCAGTCCAAACCCCTTGATCCGACCCAGCACCTCGTTGGATTCAACCCGACATACGA
ACAACTATGGGCACCAATTTGCGGTCCAGCTCACCCGTACGCAAAGGACGGGTTAGCTCAAGGACTCAGAAATCACAAGCTAGGGTTCGTTGAGG
ACGCGTCCATTGAACCCTTTGTATTTGACGAGCAGTACAATACTTTTCAGAAGTATGGGTATGCTGTTGATCCCTCTGAAAATAGCTACATCGGT
GATTTGGAAAAAATGAAGGAATGTGATGCAATTTCTGTGTATAACATACCACAGCATGAACAGAAGAAGAGGAAGTTAGAGAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E435291] SGN-U280153 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T287428 [Download] [View] Facility Assigned ID: STMJH35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0006 Quality Trim Threshold: 12.5