EST details — SGN-E435292

Search information 
Request: 435292Match: SGN-E435292
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281382Clone name: STM-61-E22
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281382 [STM-61-E22] Trace: SGN-T287428 EST: SGN-E435291 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E435292Length: 569 bp (845 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E435292 [] (trimmed) CNTTCCCTTTTTTCTCTAACTTCCTCTTCTTCTGTTCATGCTGTGGTATGTTATACACAGAAATTGCATCACATTCCTTCATTTTTTCCAAATCA
CCGATGTAGCTATTTTCAGAGGGATCAACAGCATACCCATACTTCTGAAAAGTATTGTACTGCTCGTCAAATACAAAGGGTTCAATGGACGCGTC
CTCAACGAACCCTAGCTTGTGATTTCTGAGTCCTTGAGCTAACCCGTCCTTTGCGTACGGGTGAGCTGGACCGCAAATTGGTGCCCATAGTTGTT
CGTATGTCGGGTTGAATCCAACGAGGTGCTGGGTCGGATCAAGGGGTTTGGACTGAGCTCTTGCAGCTTCGCCGGCGACTGTTAGGGCTAGCATG
GTGTCGTCGACTTTAGGGGCGGCGGATTTAGAAGGAAGCATTCGGATTGGAGAAGAATCCGGCGAAGATTGGGAATTAGGGTTAGCGATTTCATC
GTCCTCGGCGTAGGATCGCAATAGGTCCATTAGGGATTTACAGATACTGTGAAAATCGGAAATATTGAGTAATAATCAAAGTTTTGTAGCTGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E435292] SGN-U280153 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T287429 [Download] [View] Facility Assigned ID: STMJH35TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.991 Expected Error Rate: 0.0156 Quality Trim Threshold: 12.5