EST details — SGN-E435495

Search information 
Request: 435495Match: SGN-E435495
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281537Clone name: STM-61-L7
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281537 [STM-61-L7] Trace: SGN-T287631 EST: SGN-E435494 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E435495Length: 464 bp (928 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E435495 [] (trimmed) TTCTTTTTTTGAGGCGAACGAAATACCAGTTACATGGAATTGATTCTCGTTACACAAATACATACAATTTGTAAAACTCAGATATATTGGGGAGA
GGCGAGCAAGAGAGGGAGAGATACAAGCGAGAGAGCTAGTGTATCTCATATACATACAAATCACGCTTAGATATTAGTATATCTAGTATAAATTA
CACCTAATTTGACCCGCATATACCTAGGGGTGGCAAGTTTCGAACAGGCAATCTCAAGGGTGAAAAGTGATAAAATTATCAGATGAAGTGTTCTT
GCGTGACATACTATAACTTAACTAATGTTGCATCTGTTAGTGGTAGTGCCCCCATTTGTTGTTTCATTGGTGTTTGAATTTGAGATCTCACGATA
CTAAACGCACTTCATTAATAACTAACTAAGCCCCAGTCTTGGGCTCAACAAAAAATGTTACTCCTCAATCCAGCTCATATTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E435495] SGN-U275686 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T287632 [Download] [View] Facility Assigned ID: STMJI64TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0173 Quality Trim Threshold: 12.5