EST details — SGN-E435800

Search information 
Request: 435800Match: SGN-E435800
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281831Clone name: STM-62-I3
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281831 [STM-62-I3] Trace: SGN-T287936 EST: SGN-E435799 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E435800Length: 619 bp (917 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E435800 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTGGCTAACAATAATTTATATACTGTAAAAACACACATGCATGTTTATCATGATACAATATTTGTAATTTACAAAG
ATAGAAATAATATCTAGATGCATATATCGCGAAAGCGAAAATACAAAATATTACAAGAAAACAGGCATAATTTTGTGCACTGCCATATTGAAGAT
TGACAATCCAAGTAATACAAACAATTCCCCACAAACCAAACAAAGAAGAAAAAAAAACTAGACTTAATTCACACATTACTAAAAATATTATTTTT
TTTAAAAGTACAAATTAAGCTTATGATAAAATGGAATAATAAAATGTCTCCTTCTTGACCATCATCACATGGCTCTAACAGCTTGGAATCTTGGC
TCTTTAGGTGAAAATTTTTGTTCACTATAAACATTCATATAATCACCAAACTTAAAAGCTGGATAATTACTAATTAATTCCACCTTATTGGTGGC
GGTATTATTATCATTATCAATATGAATTAGTTGAGGTGCAGGAGCGATCGTAGCTTTTAAAGACGGATTATAAAAAGACGCAATTGACCTTCTAT
TACCATTTTCCTTTGCTAAAACGCGATGCCAAACACTCTTGTATTTCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E435800] SGN-U279278 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T287937 [Download] [View] Facility Assigned ID: STMJK50TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.924 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5