Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E435923

Search information 
Request: 435923Match: SGN-E435923
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281675Clone name: STM-62-C12
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281675 [STM-62-C12] Trace: SGN-T288059 EST: SGN-E435922 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E435923Length: 664 bp (867 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E435923 [] (trimmed) TTTTTTTTTGGGAAAATAAACATCTTTCATTTCAGCTGCCATATAGAATATAAATATCAAGTTCCTGACCATTACAAAAGTACTCCATCCATTAA
CAAATCAATAAACAGTAAGACCAACAAAAATAATTTAATGAACCATTCTTGTAAAACTTAAGGGGAATCAAGAAAACATAACATTAATCACCTAG
AACAACAAGAGTAGCCCTGCTTTTGTTTCGATCCATCGGTACCATCGTTGACCAGGTTAACTCTGTTGACAGATAATTCTGCTTTATAAGAATCG
GAATTCAAAACCTTTCTGCTAACACTATTATAGATCTCTCGAATCACAATCTCAAAAGCCTTGTTTACGTTTGTTGAATCGAGGGCAGATGTCTC
CATGAAGAACATCCCTTCTGATTCTGCCAGGCTTTTGCCTTCTTCTACGCTCACAGCTCTTATGTTCTCCAAGTCACATTTGTTTCCCACGAGCA
TCCTTGCAACCGTTGTATCAGAATGAGTTTTGAGTTCATTAAGCCAACGAGGGATGCTATCAAAAGTTGTCCTCCTTGAAATATCATAAACAACA
AGAGCACCAAAAGCACCACGATAATAAGCAGAAGTCACAGCTCTAAACCTTTCTTGTCCAGCAGTATCCCAAATCTGAGCTTTAACTTCTTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E435923] SGN-U278813 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T288060 [Download] [View] Facility Assigned ID: STMJL18TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0014 Quality Trim Threshold: 20.5