EST details — SGN-E436165

Search information 
Request: 436165Match: SGN-E436165
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281842Clone name: STM-62-J13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281842 [STM-62-J13] Trace: SGN-T288303 EST: SGN-E436166 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E436165Length: 625 bp (863 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E436165 [] (trimmed) TCGGATTTCAGTGACGGTAATCGTGCTGTATCAGTTCGGACCCGCAGATCAATGAATGTGAGTACTAGGTTAAGGGGTCCTGTTCAGGATTCATT
GCATACTAAGTCTTCTGGCTCAAGACAAAATTTACCTGAGCCTGGAACTCCAAATCTAGATATGCCTAGTTCATCCAGTCAACTTTTCATGGATT
CTTCATCAAGTGATTATAGCACTTATAGTTTACCTGCAAATGATTATGATGATGATGATGACGACGATGAAGATGAAGATGATGATTTACCTGGT
GTAGTACCATTCACTTCAGCAGAAATCGGCATTAACGGTATGAACCGTGAAGCATTGCAGCGATATAACATGGATGGAGTTGCTCAGGTATTGCT
GGCACTTGAGAGAATCGAACAAGATGAAGAGTTATCTTATGAGCGACTACTGGCGTTGGAGTCCAATTTGTTCCTCAGTGGCCTTAACTTCTATG
ACCAGCATAGAGACATGAGACTAGATATCGATGACATGTCCTATGAGGAATTATTAGCACTTGAGGAGAGGATTGGCTCTGTTAGTACCGCTCTG
CCTGANGAAGAACTATCGAAGTGCCTCAGGAGAAACATTTATCAGGGTATGGCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E436165] SGN-U278942 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T288302 [Download] [View] Facility Assigned ID: STMJM55TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0073 Quality Trim Threshold: 14.5