EST details — SGN-E436304

Search information 
Request: 436304Match: SGN-E436304
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281750Clone name: STM-62-F16
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281750 [STM-62-F16] Trace: SGN-T288440 EST: SGN-E436303 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E436304Length: 671 bp (854 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E436304 [] (trimmed) TTTTTTTTTTTGTTGGAAAAGATACCCATTTCATCACAACATTGGAATGACAACACTCTGGAATTTCCTACTATGCAAAAATTTAAGAAGCAAAT
AAAACTATTTAAACTTCTCCTATACCAATTTCCCCCACAATTCATCAGTAAGTTGTAAAATGAAAACAACCCCAAATCTCCTCCTATAATATCAA
CACTCCACATTAGCTTTTTGAGCCAAAGGAATAGCAGCAATTGCATTATCACCAGTTTCAGGCAACTTCCTCTTGGGCTTAGCCTCTTGCAACAT
AGATATAACATCCCTCATCGATGGCCTGTCAGCCGGGTTACGACTAGTACACAGCAATGCCACCCTCAGCAACAACATCATTTCCTCCCTAACTG
AAAGACATGAAGCGCCAGCATTTTTATCCAACACATCATTTATGCCATTTTTAGTCTTGATCTTCGACTTAACCCAATCCACAATGCTATTTCCA
TCGCCAAATTCTGGTTCCACCGATCTTTTCCCTGATAAAATTTCAAGTAACACAACCCCGTAGCTGTAGATGTCACTCTTCTCATCAACTTGCAA
TGTGTATGCATATTCAGGTGCAATGTAGCCATAAGATCCAGCAATCACGGACATAGATTCATCACACTGAATCAACTTTAGCACACCAAAATCAG
CCACTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E436304] SGN-U281764 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T288441 [Download] [View] Facility Assigned ID: STMJN32TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0063 Quality Trim Threshold: 12.5