EST details — SGN-E436546

Search information 
Request: 436546Match: SGN-E436546
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C282126Clone name: STM-63-K23
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C282126 [STM-63-K23] Trace: SGN-T288682 EST: SGN-E436545 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E436546Length: 680 bp (843 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E436546 [] (trimmed) TTTTTTTTTTACCAAAAAATAACAATATTATAAAAGAATGCAAAGCAACCAAGCAAGAATCACCCATTCTAGTACTACTCTCATCGAAGCATGCT
TAACTCATGGAATCCGATGCGATAGTACTGGTATGATCACATCCTATTTTCAGAAACCAAGCAACTGGTTTATGTTTTGCATGGATCTTTGGTTG
TATACAAGACTCCAAAATTTTACTAAGTACATTTTCATGACTCTGCTGGGAAGAAAGAGCCCCCCTTATTGCAAGAGTGATGGAAGTAATCATAC
AGAACTAAATTAGAATACAGAAGACTCAGCTAGCTATTATTATACTATGAATGGTGATTTTGGCTTCTGAAACTCGAAGAAAAGAAACCATGGAT
ACGTCAGATAAAGGTTAAGCTGGGGAGAACGCGTTGCACAATGACTTGTATGCAGTGACGCAAGTTTTAAATTTCTCTTCTGCTGCTGCCTGTGA
AGGGCCTTGATGTTTATCAGGATGCCACTTTAATGCTGATAAACGGAAAGCATTCTTGACATCCTCAATCTTCAGAGGACCTCTTGGGGGCAAAC
CGAGAATTGTTCTTTCAGAGTAAGACCCTATATTACATGATCCATATTTGGATTCTGTATGTGTCTCGTTTTCAGTTTCATTATCCCATCTGTAA
TGCCTTTGTTCTGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E436546] SGN-U276761 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T288683 [Download] [View] Facility Assigned ID: STMJO72TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5