EST details — SGN-E436555

Search information 
Request: 436555Match: SGN-E436555
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C282137Clone name: STM-63-M11
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E436555Length: 578 bp (869 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E436555 [] (trimmed) TTTTTTTTTTTTAAGCAAAAAGATATANTTGAAAATACCACCTCCGAAAGTCTATAAAATACAACTTATTCAAAATTCAAATAGAATTCAACTCC
TAATTAAAAGTGCTAACTAGTTGACTAGGTTTATCTTAATAAAATTACTTGCAGTAATAATTTAACAATCCTAAAAAATAGAAGAGCTTCAGCAC
TGTTGTTCCCTTCCGGTAGCGCTACACTACAATGTGTATCTTTGCATTTCACATTTTACCAACTCACATCCTGCCTGACATGAAGCAACAATGGA
GGAGAAAATCCTCCTCTGTAAATCTTTGAAATCCACTGCAAGCTTTACATCCCAACTTGTGGTCTCCCTGTTATCCAATTCAGGATCTCCTAGCC
CATCCCGCATTTCTTCGAACATAGAACAAAGGTCCCTAAGTATTTCGAGTTCAATTTCCAAGTTCTCTGGTGTCTGTAAAGATTGATATATGTAT
TTCAGGTGAAGTAAATCATATTAGCTAATTAGGTAAGTGGAAAAAAAGTTGATAAAATTAAGAAAGTATGCAATATGTATAAGGGTTATGGGGTA
AAGAAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E436555] SGN-U278269 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T288692 [Download] [View] Facility Assigned ID: STMJO78TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0077 Quality Trim Threshold: 12.5