EST details — SGN-E436622

Search information 
Request: 436622Match: SGN-E436622
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C282032Clone name: STM-63-C18
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C282032 [STM-63-C18] Trace: SGN-T288760 EST: SGN-E436623 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E436622Length: 262 bp (920 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E436622 [] (trimmed) CTTTAAAAGTGGCTCAAATTTTACTTGTTTGATTAGAATAACTTGGAGTATGCATGCCCCCAAGGCCTAGCTCAAGTGGCAAAAGGTGGAGGATT
TGTGACTTAGGTCCCAGGTTCAAGCCCCACACCATGCAAAGCGAAGCCCGGTATTTAAGTGGAGAAGGGTAGAGGGGCGGGCCCATTATCCACCG
AGTTTGGAAGGCTGTGATTGGTCCAAAGGGCGGGTCACAGACGGATTTCTCGGTTATCAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E436622] SGN-U268091 Solanum tuberosum Build 4 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T288759 [Download] [View] Facility Assigned ID: STMJP21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0002 Quality Trim Threshold: 12.5