EST details — SGN-E436667

Search information 
Request: 436667Match: SGN-E436667
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C282108Clone name: STM-63-I4
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C282108 [STM-63-I4] Trace: SGN-T288805 EST: SGN-E436668 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E436667Length: 760 bp (884 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E436667 [] (trimmed) GTCATGAAGGAGCTTCTTGTGGTTTCTCCAGACTCAGCAGAAGAAGTGACTGCTCGTGGCGAAACTTGCCTTCATTTAGCTGTCAAGAATCATCA
GTTTGAAGCATTCAAGTTATTACTTGACAATCTCAAGGATGATCTTTTAAACAAGAAGGATATCCAAGGAAACACTGTTTTGCATCTTGCTGTCT
CAACTAAGCAATACGAGGTTGTTGATATGTTGCTGGATGAGAATGTTGTTTGTAAGGGCACAATTGAGGTGAATTCTTTGAACAAGAAAGGCCTT
AATTACACCTTTGGAGGTACTATTAGAGGAATGTGGAGATAGAGATATTGAGGAAATTCTAAGAGCATCTGGTGCTTTATCTGCTGAAAACTTGC
AAGTTTTGGTTGTTCCAGTTCAAGATCAACAATTCAGCAGAGAACAAACAAGGGACGATGGGCCTCGATCTAATGTTAAGAAGCTTCAGGATTTC
TTCAAGTACAATAAGACCAAAGATCCTCCAGGAAAAGTAAGAGACACCCTTCTTGTGATAGCCATTCTAATTGCAACAGCAACTTATCAAGCAGG
TTTCAATCCACCAGGAGGCTTATGGCGGGATACTTACTGGCCTGACGACAATAACATTAACAGTACTAGTCATGATGGCATAGTAGTAGTGACCC
TGCGGCATTTCGCAAGACAGTCAGTGATGGCTACCAGGGGTCCAATGCTCTATGGCTTGCTCTTGGTTTTCAACTCCCTCGGATTTTTCGTATCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E436667] SGN-U282114 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T288804 [Download] [View] Facility Assigned ID: STMJP50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5