EST details — SGN-E437192

Search information 
Request: 437192Match: SGN-E437192
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C211097Clone name: cSTA-3-A23
nocartOrdering Not Available
Library Name: cSTAOrganism: Solanum tuberosum

Tissue: Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers
Development Stage: 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E437192Length: 442 bp (853 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E437192 [] (trimmed) GAAAGCTAGGGTTTACCAGTTTCTGCAATTTCGAAGATTTTGAATCTGTAGTAATCGGAAAAAAGCTATGGACCCGATGAAGTTGAATCAATTGA
AGCAATTCGTCGAACCAGTGCAAATCCAATCCTTCCATTCTCTCCGATCCTTCTCTTTCATTTTTCCGTGACTACATTGAGAATCTCGGTGCTAA
ACTTCCTCCGGCTGCTTACGACACCGGCGATTACAAAGAGAAGTCTCATGCGGTGGATGCGAGTGATGACGAAATGGATGATGTTGAGAATGATG
CTAGTACGAAAGAGACAGTTGAAGAAGAGGAGGAGCCTGAGATAATTGAATCCGATATTGAGCTCGACGAGAGTGACACCGTGGAACCTGACAAT
GATGAGCCACAGAAGATGGGAGACCCTTCCGTGGAGGTTACTGAAGAAAGCCGTGATGCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E437192] SGN-U269473 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T201833 [Download] [View] Facility Assigned ID: PSTAI12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0076 Quality Trim Threshold: 14.5