EST details — SGN-E437445

Search information 
Request: 437445Match: SGN-E437445
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C211156Clone name: cSTA-3-D22
nocartOrdering Not Available
Library Name: cSTAOrganism: Solanum tuberosum

Tissue: Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers
Development Stage: 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E437445Length: 396 bp (881 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E437445 [] (trimmed) TAAAACCCTGGGCACTACATTACTGGTCCTTTGCCTCTATTTCAATTTCAATCCAAATTAGCAACTGATTGTAACATATTTTTGCAAAAGTTGTG
AACTTTAAGCTCACAATTGAATCATGAAGAACCTGAAAAAGAAGAAAGCTTCAGCTCAAAACATCCAGAAGGGTAGTAAGAAGAGATTTTCAGTT
GAAAGCGACCCATTTTTCAATGAAGACAACGACTTGAAAAGGCGAAAGAGATTTGGAGATGATGAAGATATTGAGAGCAGTGATGATTCAGAGGA
CATTTATGGGTCTGATGATGAAGGAGTGGATAGGAATGAGAGGAAGGATGAAGAAGAGGAGGAGGAGGATGAGACGGCATCTGTGAAGAGAAAGA
GGCTGGCGGAGACATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E437445] SGN-U270563 Solanum tuberosum Build 4 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T202086 [Download] [View] Facility Assigned ID: PSTAL23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0174 Quality Trim Threshold: 14.5