SGN ID: SGN-C216169 | Clone name: cSTA-7-L13 |  | Ordering Not Available |
|
Library Name: cSTA | Organism: Solanum tuberosum |
Tissue: Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers
Development Stage: 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E438380 | Length: 248 bp (877 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E438380 [] (trimmed)
CTCAATTATCCATCACCTGCTGGTATACAAAGACCAAAAAGTGACGAGGATATCGCATTCATGAGTATTCTTGAACTTGGTCAGCTTCTCAAGGC
AAATTTAATCACATCAGTGGAGCTGACTGGAATTTTCTTGAAGAGACTGAAGAGGTATGGTCCTGTTCTTGAATCGGTCGTTACAATTACTGAAG
AATTAGCATACAAACAAACAAAAGAGGCTGATCAACTGCTTGCTGAAAGCAAATATTT
[BLAST] [AA Translate]
SGN-ID: SGN-T203021 [Download] [View] |
Facility Assigned ID: PSTBA67TH
|
Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 |
Expected Error Rate: 0.0178 |
Quality Trim Threshold: 14.5 |