Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E440268

Search information 
Request: 440268Match: SGN-E440268
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C207967Clone name: cSTA-16-M5
nocartOrdering Not Available
Library Name: cSTAOrganism: Solanum tuberosum

Tissue: Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers
Development Stage: 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E440268Length: 442 bp (857 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E440268 [] (trimmed) ACCACACAGCAGAAAAGCAAAATCTTCTTGTTCAAGCAGCAGCAGCAGCAGTAGCCATGGCGAAACGTTTGATCCCAACACTTAACAGGGTTTTG
ATTGAGAAAATTACAGCTCCTGCTAAAACAAGTGCCGGTATTCTTCTCCCTGAAAAGTCCTCTAAGCTGAATTCCGGGAAAGTGGTGGCTGTTGG
TCCAGGACTTCATGACAAGACAGGGAACTTAATCCCTACTGCTGTCAAGGAAGGTGACACCGTCTTGTTGCCCGAGTACGGTGGTACTCAAGTCA
AGTTGGGGGAGAAAGAGTTTCATTTGTACCGGGATGAAGACATTTTGGGGACACTGCACGACTGAGCATCTATAACGTTTGAGTTTTCATTCACT
CTGTTGAGGTTTATTTAAGGGGGTTGGGGAGGTTAATTTCAAGGATGTTTTTGGTTTAAGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E440268] SGN-U271436 Solanum tuberosum Build 4 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T204909 [Download] [View] Facility Assigned ID: PSTCI75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0223 Quality Trim Threshold: 12.5