Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E441965

Search information 
Request: 441965Match: SGN-E441965
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C211916Clone name: cSTA-31-L11
nocartOrdering Not Available
Library Name: cSTAOrganism: Solanum tuberosum

Tissue: Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers
Development Stage: 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C211916 [cSTA-31-L11] Trace: SGN-T206605 EST: SGN-E441964 Direction: Unknown Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E441965Length: 516 bp (758 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E441965 [] (trimmed) CTCTTCAGCTGTGCCGCATATCGCCTAATTTCTCTTCTCTAAGTTTCTTAGTCTCTCAAGAAGGGTAAAGAGAAAAATCACATCAGCATTGTGGT
CATTGGCCACCGTCGACTCTGGAAAGTCGACTACCACTGGTCACTTGATCTACAAGCTTGGTGGAATTGACAAGCGTGTTATTGAGAGGTTCGAG
AAGGAAGCTGCTGAGATGAACAAGAGGTCATTCAAGTATGCCTGGGTGCTTGACAAACTTAAGGCTGAACGTGAGCGTGGTATCACCATTGATAT
TGCTTTGTGGAAGTTTGAGACCACTAAGTACTACTGCACTGTGATTGATGCCCCCGGACACAGAGACTTTATCAAGAACATGATCACTGGTACTT
CCCAGGCTGACTGTGCTGTCCTCATTATTGACTCCACCACTGGTGGTTTTGAAGCTGGTATCTCTAAAGATGGTCAGACCCGTGAACATGCATTG
CTTGCTTTCACCCTTGGTGTCAAGCAAATGATCTGCTGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E441965] SGN-U277726 Solanum tuberosum Build 4 467 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T206606 [Download] [View] Facility Assigned ID: PSTES66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0202 Quality Trim Threshold: 14.5