Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E444878

Search information 
Request: 444878Match: SGN-E444878
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C215251Clone name: cSTA-44-O23
nocartOrdering Not Available
Library Name: cSTAOrganism: Solanum tuberosum

Tissue: Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers
Development Stage: 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C215251 [cSTA-44-O23] Trace: SGN-T209518 EST: SGN-E444877 Direction: Unknown Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E444878Length: 259 bp (803 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E444878 [] (trimmed) CTTTGTCCCCATCTCTGGTTTTGAAGGAGATAACATGATTGAGCGATCAACCAACCTTGACTGGTACAAGGGCCCAACCCTACTTGATGCTCTTG
ACCATATTAACGAGCCCCAGAGGCCCACAAACAAACCCCTCCGTCTTCCACTTTAGGATGTCTACAAAATTGGCGGTATTGGAACTGAGCCCGTC
GGTCGTGTTGAAACTGGTGTCATTAATCCTGGTATGCTTGTCACTTTTGGTCCAACTGGTCTGACCACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E444878] SGN-U277731 Solanum tuberosum Build 4 274 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T209519 [Download] [View] Facility Assigned ID: PSTGQ96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0279 Quality Trim Threshold: 14.5