EST details — SGN-E448587

Search information 
Request: 448587Match: SGN-E448587
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C244313Clone name: cSTS-3-L9
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E448587Length: 672 bp (867 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E448587 [] (trimmed) GAGAAGTCCACACAAGTCCAAGCGTATATTTGTGATTGAGCTAACAGATCCAGGATTGTTGATTGTGAGTAGACTAAGTGTTTGTTGAAAGAGAA
ATGGCAAGGAGAGCAGACGAAGAGTACGATTACTTGTTCAAGATTGTGTTAATCGGAGATTCTGGAGTTGGCAAATCCAATTTGCTCTCCAGATT
CACTAGAAATGAGTTCTGTTTGGAGTCTAAATCTACCATCGGCGTTGAATTTGCCACTCGTACTCTCAAGGTAGAGGGAAGGATCATTAAGTCTC
AGATCTGGGACACGGCTGGACAGGAGAGATATAGAGCCATTACAAGTGCATACTATAGGGGTGCTCTTGGTGCTCTTCTGGTATATGATGTGACA
AAACCCATTTCCTTTGAAAATGTCAGCCGGTGGTTAAAGGAACTGACGGATCATGCATACTCCAATATTGTGATTATGCTGATTGGAAACAAGAC
AGATCTGAAGCATTTGCAAGCAGTTGCTACAGAGGATGCTCAAAGCTATGCTGAAAGAGAAGGGCTTTCTTTCATAGAAACATCAGCCTTGGAGG
CAACAAATGTTGAGAAGGCTTTCCAGATGAATCTTTCGGAAATTTATCGGATAATCAGTAAGAAGTCACTCTCTTCAGAAAACACTGCACCTGCT
AACATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E448587] SGN-U271031 Solanum tuberosum Build 4 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T234163 [Download] [View] Facility Assigned ID: PEYAK65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0090 Quality Trim Threshold: 14.5