Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E448594

Search information 
Request: 448594Match: SGN-E448594
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C244330Clone name: cSTS-3-N1
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E448594Length: 613 bp (896 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E448594 [] (trimmed) AGAGATTGTAAGCAGTGATCTGTGAAGATGACCAAACTTCATGCTTTTAGTGACTTGTTGGAGCACAACAACAAAGATGATTGCTGGCTTCTCAT
CTCTGGAAAGGTTTATGATGTAACCTCATTTTTGGATGATCATCCTGGAGGAGATGAAGTCTTGCTAACTGCAACAGGTAAGGATGCAACAGATG
ATTTTGAAGATGTCGGTCACAGTGATGATGCAAGAGAGATGTTGAAGAAATACTTCATTGGTGAAATTGACAGTTCCACCATTCCTGCAGAACGC
AAACATACCCTGCCTTCCTCAACGACACCATCAGCTGGAGTACAGGGTTCTGGAAACTCATGGAAGATATTGCAATTCTTGTTACCTTTGTTGAT
ATTGGTTGCAGCCCTCGCCTTCCGTTCCTTTTACCAGAAAGAATAGATCAACTGCCATGTTTCAAGATGCGACTGGATACAATAGAACCTTCTCC
TCTGCAGCTTGTCATTTCATATGTTGTGCTTCCCTATTCAGCTTATTATGTGTATTTGCTACCTTTGTTGGATGTCCCTTACTGGGATAATGAGA
TATTAAGATGTTGTTAGCTCTGTCGGTAATGTTTTCTGTTAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E448594] SGN-U271712 Solanum tuberosum Build 4 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T234170 [Download] [View] Facility Assigned ID: PEYAK73TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0041 Quality Trim Threshold: 12.5