EST details — SGN-E449476

Search information 
Request: 449476Match: SGN-E449476
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C245510Clone name: cSTS-6-J15
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E449476Length: 701 bp (973 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E449476 [] (trimmed) GCAACTATGAAGATGTTTATGATGTTAGTGGTGGCTGCAATTATGTTTTGCAGCCATCACCAAGTGGTCGTGGCAAGAGAAGTCGTTGTGGACGT
GGACGTGGTCGAGGACGGGAACAAGTTAAAATTATGGCCATGGGAAATTCCATGTTATTTACCATGGCCATTTCCCTTTCCACGACCATATCCAT
GCCCTCCTCCAAAACCACGACCAAGTCCACCACCTCCACCACCAAGCCCTTCCCCTCCCCCTCCCGCCCCGGCAACAACTTGTTCGCCAGGTGAC
AAAGCAAAGGTGAAGAAGTGCATGTGCAACACAACTTCAATTGATGAATGTTGTCCAACTTTTCAAAACATACTTGGCACTAGTTGCCCTTGTTA
TAAGTATGCTGAGGAGTTCGACAATCAACTCTTGATCACTCTCGAAGCTTATTGTGATGTTGTTACCCCTTGTAGGAGCCCACCCCCAAAACCGA
GTTGCTCGGCTAGTGACCAAGAAAAAGTGAAGACTTGCATGTTCAACACAACTTCAATTGATGAATGTTGCCCCACATTTAATAGCATACTTGGC
ACTAGTTGCCCTTGCTATAAGTATGCTGAGGATTTAGATAATCAAGTCCTGATCACTCTCGAATCTTATTGGGACGTTAATAATCCTTGCNACAG
TGTGCAAGTGATTTAGCTATCCAGGATGATGAGTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E449476] SGN-U281337 Solanum tuberosum Build 4 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T235052 [Download] [View] Facility Assigned ID: PEYAW56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.987 Expected Error Rate: 0.0101 Quality Trim Threshold: 14.5