Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E449934

Search information 
Request: 449934Match: SGN-E449934
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C245938Clone name: cSTS-7-N12
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E449934Length: 709 bp (880 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E449934 [] (trimmed) TGTTCAATCCAAAAGAGTTTTGTTTGCTTTCGATTCATCTGATTCTTCAGCTACAGTGGAAAAACTGCTTAGACTTCTCCTATAAAGCTGCTGCA
GTCCCTGAATTAACTGGGTGATTGTGAAGAGCAGAAGAATTTTTCATTCTGGTGAACTCATACTTGCACTGCTTAAGACTTTTGCATCCCATGTT
TCCTATACTTATCTCTCAGTCAGTGGACTTAGATGGCCATTTCCTCATTGGGGCTACACCGGAAAAGCCAAACTAACCAGTTTCAATTATTAATG
GAGCAAGCAGATAACCGTAGCAACAATGAGCATGTTATTGACATAACTACTAGCAACGATGCATCCTCATCTAGCAACCCCCATGATAGACCAGT
TAATAATGTGCTTCATGTCCAAGCTGAACATCCCCCATCAACAAGCACAACAGTGCCCGTCTCCCAACATGCATTTTCTTCTGCTAATAGATCCA
ACTTGAGGAACTCATCATTTGCTCGAAGAGGAAATGGGCGCCGCCATCGGAGTCCTCTGAATTCCGTGCTCTGGATATCCATTGAACTAGTCTTG
ACAATGAGCCAAATAATTGCAGCAATCGCGGTGTTGGCCATATCAAGGGATGAGCACCCACGAGCTCCTCTATCCCAATGGATAGTTGGTTATGC
ATCTGGGTGTGTAGCAATCCTACCTCTTCTCTACTGGCGTTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E449934] SGN-U282071 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T235510 [Download] [View] Facility Assigned ID: PEYBB78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5