EST details — SGN-E450094

Search information 
Request: 450094Match: SGN-E450094
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C246185Clone name: cSTS-8-I18
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E450094Length: 512 bp (915 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E450094 [] (trimmed) GAACAATCATCAGATTTTTTCTGCAGTTTCTCTAAAAAAGAGGCGCTTGCGTTTTTGAAGGGCAAGCTTGAAGGCAGTGACAAGTTCTCAGTGGA
GGGAAAGAGGGTGTCTCTTTCTTAAAGAGAACTGAAAGAATTTTGCCGTTGCTGAGATTAACTGTAGTAACGAAATGTAGATGGCCACCGAGACT
AGGTTCACAGTAAATCAATTTTATTTTGTTTTGCTGAGTATATCAAGGAGCACAGCATTGCGTTTAGGGGAGTACAGCATTTAGGCAGTCATTTC
TTCATCCAGTGATCTGCCCTTGTTCTTTTTCTTCTCCTCCTCTTCTACTACCCTCCCCGCTGTTTTGTTTTAATCTTTTTTTTGGGTGATGATTT
GTGTGTTTTTGGCCAAGGAATAGAGGTCGGTATAAGTTGTATTATTTATTTAACAGATGCATAATTATTTGATTGTTACACATTTATAATTTTGT
TATTGCACAAATGAGATGAGAGATTTAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E450094] SGN-U273566 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T235670 [Download] [View] Facility Assigned ID: PEYBD57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0002 Quality Trim Threshold: 12.5