EST details — SGN-E452008

Search information 
Request: 452008Match: SGN-E452008
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C239174Clone name: cSTS-15-G20
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E452008Length: 706 bp (897 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E452008 [] (trimmed) CCTGTCTGATACCTGGTGCTATCATTTCTCTTTTTACCAGGCTTGCCATTGAGAAAACTCTGACCTCTAAATTAGAAGGAAGGCTCGAAATTCTA
TTCAACTCAGGATTGTGAAAGCTCTTAGAGAATATCGAAATCTCCATGCTGTTCAGCACCGTGTGGCCGGAAGGATGATATATCCAGAATCTTTA
AAGTACTTACCATTATATGGATTAGCTTTATGCAAAACAACTGCCCTTCGTGGTGGATATGCTGATGCTCAGCTTGATGAACGATGTGCTGCTGG
ATATACCATGATGGCTTTGCCCGTTAAAAGATTGTTGAAGCTTCTATATCCTAAGTTGATCCGTATAGATGAATATCTTCTAAAAAAACCATCTT
CACCTGAGGAGTCTAAAGACATCTTGAAAGGGGTTCCACTTACATCAGAGAGCTTAGATCCCCAGGGTCTCTATCTCTATGATGATGGTTTCCGG
TTTGTCATCTGGTTTGGTAGAATGCTTTCTCCTAATATGATCCAGAGTTTGCTCGGAGAAAACTTTGCTGCTGACTTCTCTAAGGTTTCACTTCA
AGAGCTAGATAATGAAATGTCAAGAGAAACTGATGGGTTTGCTTAAAAGGCAAAGGGAAAACGACAGATCATACTATCAACTATGCCATCTTGTG
AGGCAAGGTGAACAGCCTAGAGAAGGCTTCTTCTTGCTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E452008] SGN-U279197 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T237584 [Download] [View] Facility Assigned ID: PEYCF46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0086 Quality Trim Threshold: 14.5