EST details — SGN-E452854

Search information 
Request: 452854Match: SGN-E452854
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C240220Clone name: cSTS-18-M3
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E452854Length: 692 bp (857 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E452854 [] (trimmed) TTTTTTTTTTTTCTTCTTCTTAAATATTTTATTTTTCTTCAAACTATATAGTAATTTCACTTCCATTTGAAGAGAAGAAAATGGCAAAGAGTGGT
CACAATGCTAGCTTCTTGTTGCTTCTCTCAATGTTCTTGATTTTGCTCACTTTCTCTAATGTGGTCGAGGGTTACAACAAGCTCCGCCCAAGAGA
TTGCAAGCCAAAATGTACTTATAGATGCTCAGCAACATCACACAAGAAGCCATGTATGTTCTTTTGTCAAAAATGTTGTGCAACATGTTTATGTG
TTCCTAAAGGAGTTTATGGCAACAAACAATCATGTCCTTGTTACAACAATTGGAAGACTCAAGAAGGAAAACCTAAATGCCCTTAATTAATTAGG
GAAATTAATCTTTTAATTTTTTCCAATAATTAATGGAAAAGATTAAAAGTACTATAGCTATATTGTATTGCATTAAATTGATTTCTATTTTGGAG
TACTTTTGATGTAATGTTTTAAGTATTTTGTATTTCTCTACTTATGTTATAATGTTGTCGGAGTCTAAGATGAGTTGTAGTACTGGAGCGATATA
TGATCTATGTATTAGGATTCATATAGCCGTCTTCAACTTGCTTGAAGATAAAGTGTTATTGTAATCTTTCTTTTTTTACAACGAGAATATAATAA
TAACTTATTTATTGAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E452854] SGN-U276548 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T238430 [Download] [View] Facility Assigned ID: PEYCQ74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0034 Quality Trim Threshold: 12.5