Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E453052

Search information 
Request: 453052Match: SGN-E453052
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C240280Clone name: cSTS-18-P23
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E453052Length: 460 bp (917 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E453052 [] (trimmed) CATTCTTGTTCTTTGTAGTGTTGGTGGTGTGCAAAGTCAGTCTATCACTGTTGATAGGCAAATGAGAAGATATGATGTCCCAAGACTTGCTTTTA
TTAATAAACTTGATCGGATGGGGGCAGACCCTTGGAAAGTTCTTAACCAGGCAAGATCAAAGCTTCGGCATCACAGTGCTGCTGTGCAAGTTCCG
ATTGGGCTAGAAGATGACTTCAAGGGTCTTATTGATCTCGTGCAGTCAAAAGCTTACTATTTCCATGGTTCCAATGGTGAGAAGATTGTCACAGA
AGATATTCCTGCTGATATGGAAGCAATTACTTCTGAGAAGCGGCGAGAGCTAATTGAAGCAGTCTCTGAGGTTGATGATAAGCTTGCTGAATCAT
TTCTGAACGATGAGCCTATATCATCTGCTGATCTTGAGGCAGCCATAAGGAGAGCGACAATAGCACGGAAGTTTGTTCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E453052] SGN-U271113 Solanum tuberosum Build 4 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T238628 [Download] [View] Facility Assigned ID: PEYCS96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5