EST details — SGN-E453361
| Search information |
| Request: 453361 | Match: SGN-E453361 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C240315 | Clone name: cSTS-19-B6 |
| ||
| Library Name: cSTS | Organism: Solanum tuberosum |
Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E453361 | Length: 228 bp (784 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E453361 [] (trimmed)
GTCTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGAGGGAACTATGACATTCAAAAACAATCAATTTGCTACAATGAAATATTGCAAT
TACAAAATGCAAGTGTCATAAACATAATATAATAAAAGAAAGAAAGTAAAAAAGAATGATATGGTTTTTTCAACAAAAAATCAAAAGTTGCACAT
CCTCTTACAAAATAGCATTACAAGTGCACCAAAATACT
TACAAAATGCAAGTGTCATAAACATAATATAATAAAAGAAAGAAAGTAAAAAAGAATGATATGGTTTTTTCAACAAAAAATCAAAAGTTGCACAT
CCTCTTACAAAATAGCATTACAAGTGCACCAAAATACT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E453361] | SGN-U271577 | Solanum tuberosum | Build 4 | 13 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T238937 [Download] [View] | Facility Assigned ID: PEYCX03TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.861 | Expected Error Rate: 0.0052 | Quality Trim Threshold: 14.5 |
Working
