EST details — SGN-E453361
Search information |
Request: 453361 | Match: SGN-E453361 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C240315 | Clone name: cSTS-19-B6 |
| ||
Library Name: cSTS | Organism: Solanum tuberosum |
Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E453361 | Length: 228 bp (784 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E453361 [] (trimmed)
GTCTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGAGGGAACTATGACATTCAAAAACAATCAATTTGCTACAATGAAATATTGCAAT
TACAAAATGCAAGTGTCATAAACATAATATAATAAAAGAAAGAAAGTAAAAAAGAATGATATGGTTTTTTCAACAAAAAATCAAAAGTTGCACAT
CCTCTTACAAAATAGCATTACAAGTGCACCAAAATACT
TACAAAATGCAAGTGTCATAAACATAATATAATAAAAGAAAGAAAGTAAAAAAGAATGATATGGTTTTTTCAACAAAAAATCAAAAGTTGCACAT
CCTCTTACAAAATAGCATTACAAGTGCACCAAAATACT
Unigenes |
Current Unigene builds | |||||
[SGN-E453361] | SGN-U271577 | Solanum tuberosum | Build 4 | 13 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T238937 [Download] [View] | Facility Assigned ID: PEYCX03TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.861 | Expected Error Rate: 0.0052 | Quality Trim Threshold: 14.5 |