EST details — SGN-E453484

Search information 
Request: 453484Match: SGN-E453484
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C241163Clone name: cSTS-20-M5
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E453484Length: 702 bp (878 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E453484 [] (trimmed) TAATCAGTCAAGTTTTGCTAAACGATGTGAATATATGAATACAATGGGGTCACTTCTTTGGTGGATAGTTGGCTTTTACTGGATAGTCTCTGGTG
GTGAAATTCTTTTACAGAATGCTCCACATTTATACTGGTTGGCAGTTGTATTTCTGGCATTCGATGTATTCTTTGCCATCTTTTGTGTTGCTTTG
GCATGTCTGATAGGAGTTGCTCTCTGTTGCTGCTTGCCTTGCATAATTGCAGTACTCTATGCAGTGGGTCAGGAAGGTGCATCTGAGGAAGATCT
CAGAGTTCTCCCCAAGTATAGATTCCATATTTGCAAGAATGAGGAGAAACCAAGGGTAGGAGCTGGTAGGATGGTACCAATTGAGACAAGCAGCG
GATACCTGGCCACTGAGCGTATTCTTTTACCTGAAGATGCAGAATGTTGTATATGTCTTACCTCGTACGAGGATGGGGCAGAACTCCATGCTCTC
CCCTGTAATCATCATTTCCACTCCACCTGCATCGTGAAATGGCTTAAGATGAACGCGACATGTCCACTATGCAAGTACAACATCCTGAAGGGGAA
TGATCAGGTTTAAAGCAGAGGAGAATGAAAAACATTGTACATTGTTTCGGGTTATTAAAGCCACTTATGGAAGCTTGAAACACTACTCGCTGTAT
CCCATATCAGAACAGAAATCTGCTTTCCAACTAGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E453484] SGN-U273232 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T239060 [Download] [View] Facility Assigned ID: PEYCY75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5