EST details — SGN-E454041
Search information |
Request: 454041 | Match: SGN-E454041 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C241517 | Clone name: cSTS-21-P14 |
| ||
Library Name: cSTS | Organism: Solanum tuberosum |
Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E454041 | Length: 151 bp (767 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E454041 [] (trimmed)
GTAAAGTTCAGTTCAGGGTCTCTATAGATCGGTGNGAGCAGCTGGAAGTTATTGTTCTTTGCCTGAGCTACTATTTTGGAGTCGGGTGTCTTCTT
CTTAATTTAGCTTGAGAATGGAAAATCATGGAAAGAAGTTGTGGGATTGGATATGA
CTTAATTTAGCTTGAGAATGGAAAATCATGGAAAGAAGTTGTGGGATTGGATATGA
Unigenes |
Current Unigene builds | |||||
[SGN-E454041] | SGN-U271654 | Solanum tuberosum | Build 4 | 13 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T239617 [Download] [View] | Facility Assigned ID: PEYDF91TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.930 | Expected Error Rate: 0.0141 | Quality Trim Threshold: 14.5 |