EST details — SGN-E454041
| Search information |
| Request: 454041 | Match: SGN-E454041 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C241517 | Clone name: cSTS-21-P14 |
| ||
| Library Name: cSTS | Organism: Solanum tuberosum |
Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E454041 | Length: 151 bp (767 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E454041 [] (trimmed)
GTAAAGTTCAGTTCAGGGTCTCTATAGATCGGTGNGAGCAGCTGGAAGTTATTGTTCTTTGCCTGAGCTACTATTTTGGAGTCGGGTGTCTTCTT
CTTAATTTAGCTTGAGAATGGAAAATCATGGAAAGAAGTTGTGGGATTGGATATGA
CTTAATTTAGCTTGAGAATGGAAAATCATGGAAAGAAGTTGTGGGATTGGATATGA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E454041] | SGN-U271654 | Solanum tuberosum | Build 4 | 13 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T239617 [Download] [View] | Facility Assigned ID: PEYDF91TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.930 | Expected Error Rate: 0.0141 | Quality Trim Threshold: 14.5 |
Working
